View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14702_high_31 (Length: 238)

Name: NF14702_high_31
Description: NF14702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14702_high_31
NF14702_high_31
[»] chr2 (1 HSPs)
chr2 (26-221)||(36521428-36521623)


Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 26 - 221
Target Start/End: Complemental strand, 36521623 - 36521428
Alignment:
Q  26 atattatgatataaattctattatgtgtttgattcgtacttgataaaaattatgatttcattcttttaccatgtcatacatttggtatactatttgatga 125  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36521623 atattatgatataaattatattatgtgtttgattcgtacttgataaaaattatgatttcattcttttaccatgtcatacatttggtatactatttgatga 36521524  T
Q  126 tgaaaaagaatttattagtgaccacaatatgaatacaatgacgtccaatatttacccttataagctgataaaattcttttcattactaaagagttt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36521523 tgaaaaagaatttattagtgaccacaatatgaatacaatgacgaccaatatttacccttataagctgataaaattcttttcattactaaagagttt 36521428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University