View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1469_low_49 (Length: 227)

Name: NF1469_low_49
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1469_low_49
NF1469_low_49
[»] chr3 (1 HSPs)
chr3 (10-211)||(26857865-26858066)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 26857865 - 26858066
Alignment:
Q  10 gagatgaagcttgatgatggagttgtgacatggttttgggtaaagaacgagacgaatcaaagagttgtgtatagagaagttgtggttaagagtggtgaag 109  Q
    |||| |||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||    
T  26857865 gagaagaagctcgatgatggaattgtgacatggttttgggtaaagaatgagacgaatcaaagagttgtgtatagagaagtcgtggttaaaagtggtgaag 26857964  T
Q  110 aaacaattgcagcaattgatgatatgaaagatggtggttatgatcttttgataattggaaggaaacaagggattaacccttctcttcttacagggttatc 209  Q
    ||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  26857965 aaacaattgcagcaattcatgatatgaaagatgttggttatgatcttttgatagttggaaggaaacaagggattaacccttctcttcttacagggttatc 26858064  T
Q  210 tg 211  Q
    ||    
T  26858065 tg 26858066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University