View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1469_low_31 (Length: 259)

Name: NF1469_low_31
Description: NF1469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1469_low_31
NF1469_low_31
[»] chr5 (1 HSPs)
chr5 (99-244)||(43382798-43382943)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 99 - 244
Target Start/End: Complemental strand, 43382943 - 43382798
Alignment:
Q  99 tcagattttatttaagcacaaacaaaaatcgagttgtagagagaggttgataaaatccaatttgatgactcttccagggtatttttattttgagagtaat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43382943 tcagattttatttaagcacaaacaaaaatcgagttgtagagagaggttgataaaatccaatttgatgactcttccagggtatttttattttgagagtaat 43382844  T
Q  199 tatgagctatgatgtaattttggtgcgacacattttattttgtttt 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  43382843 tatgagctatgatgtaattttggtgcgacacattttattttgtttt 43382798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University