View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14695_low_5 (Length: 508)

Name: NF14695_low_5
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14695_low_5
NF14695_low_5
[»] chr6 (1 HSPs)
chr6 (390-495)||(21144596-21144701)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 390 - 495
Target Start/End: Original strand, 21144596 - 21144701
Alignment:
Q  390 attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaataactgtttggattaaaatcctaagtttaccagtt 489  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  21144596 attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaagaactgtttggattaaaatcctaagtttaccagtt 21144695  T
Q  490 catgtc 495  Q
    ||||||    
T  21144696 catgtc 21144701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University