View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14695_low_38 (Length: 239)

Name: NF14695_low_38
Description: NF14695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14695_low_38
NF14695_low_38
[»] chr8 (2 HSPs)
chr8 (18-122)||(36276364-36276468)
chr8 (178-237)||(36276255-36276314)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 36276468 - 36276364
Alignment:
Q  18 tctatcaagcagaagacaaaaataaccatacagagcttaattggcttttccaaaataatactgtagttatttcaagatcaggatgaaatcaaactatgga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36276468 tctatcaagcagaagacaaaaataaccatacagagcttaattggcttttccaaaataatactgtagttatttcaagatcaggatgaaatcaaactatgga 36276369  T
Q  118 caacc 122  Q
    |||||    
T  36276368 caacc 36276364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 178 - 237
Target Start/End: Complemental strand, 36276314 - 36276255
Alignment:
Q  178 aacttttatttggctgccccatatgtttaaccaatcagttgaatgtcttaatataatatt 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36276314 aacttttatttggctgccccatatgtttaaccaatcagttgaatgtcttaatataatatt 36276255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University