View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14694_low_14 (Length: 286)

Name: NF14694_low_14
Description: NF14694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14694_low_14
NF14694_low_14
[»] chr4 (2 HSPs)
chr4 (127-268)||(38592421-38592562)
chr4 (10-39)||(38592310-38592339)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 127 - 268
Target Start/End: Original strand, 38592421 - 38592562
Alignment:
Q  127 atagcatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac 226  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38592421 atagaatggtgcatacttttgttcatatgtgattgtcataatactttgcaacgtcttagattcaaattgaaaacttatggttcagcttatcaaccggtac 38592520  T
Q  227 tccgatgaatgtttgtctttattgctttatttaggtcatatg 268  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  38592521 tccgatgaatgtttgtctttattgctttatttaggtcatatg 38592562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 39
Target Start/End: Original strand, 38592310 - 38592339
Alignment:
Q  10 aatattgagaggaacaaaaattattctttt 39  Q
    ||||||||||||||||||||||||||||||    
T  38592310 aatattgagaggaacaaaaattattctttt 38592339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University