View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1468_low_20 (Length: 271)

Name: NF1468_low_20
Description: NF1468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1468_low_20
NF1468_low_20
[»] chr4 (2 HSPs)
chr4 (80-171)||(23522709-23522798)
chr4 (198-253)||(23522654-23522709)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 80 - 171
Target Start/End: Complemental strand, 23522798 - 23522709
Alignment:
Q  80 tggtttgtatttcaatacatatgatttattatgcatgtttataaaccacccttgccaccaaaattgtcataagcaacaacaatcaatgaagt 171  Q
    ||||||||||||||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23522798 tggtttgtatttcaacacat--gatttattatgcatgtttataaaccacccttgccaccaaaattgtcataagcaacaacaatcaatgaagt 23522709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 198 - 253
Target Start/End: Complemental strand, 23522709 - 23522654
Alignment:
Q  198 tataaaacacagcagagcaaatacatgtataattcaaacttcattctagcaagtgc 253  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||    
T  23522709 tataaaacaaagcagagcaaatacatgtataattccaacttcattctggcaagtgc 23522654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University