View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14685_high_7 (Length: 242)

Name: NF14685_high_7
Description: NF14685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14685_high_7
NF14685_high_7
[»] chr3 (1 HSPs)
chr3 (28-223)||(46661224-46661424)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 223
Target Start/End: Complemental strand, 46661424 - 46661224
Alignment:
Q  28 aattgaaaagaaattaaagccatgtgtattaatagttctttggattaaaaagaagattgaaatgtttgcacttctgacatgggtttaaggtgcagttgtt 127  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  46661424 aattgaaaagaaattaaaggcatgtgtattaatagttttttggattaaagagaagattgaaatgtttgcacttctgacatgggtttaaggtgcagttttt 46661325  T
Q  128 gcaggtggctagatttaacccaagaagtaacattattgcaatgtt----ttttgccacttttgtttggtg-aaaaattatatgaattttgaaaacttagt 222  Q
    |||| ||||||||||||||| || |||| ||||||||||||||||    ||||| ||||||||||||||| |||||| ||||||||||||||| ||||||    
T  46661324 gcagatggctagatttaaccaaaaaagtgacattattgcaatgttttttttttgtcacttttgtttggtgaaaaaataatatgaattttgaaagcttagt 46661225  T
Q  223 g 223  Q
    |    
T  46661224 g 46661224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University