View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14684_high_58 (Length: 227)

Name: NF14684_high_58
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14684_high_58
NF14684_high_58
[»] chr1 (1 HSPs)
chr1 (5-171)||(35402322-35402488)
[»] chr5 (1 HSPs)
chr5 (151-211)||(19411924-19411984)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 5 - 171
Target Start/End: Complemental strand, 35402488 - 35402322
Alignment:
Q  5 tgaagagcaagatttaataaggaaatatgagatgaaaatattcatgttaatctccgaaacaaaatacttctatacaaaggaacttcaaattagacattag 104  Q
    |||||| ||||||| ||||||||||||||||||| |||||||||||| |||||||  || | ||| |||||||||||||||||||||||||||| |||||    
T  35402488 tgaagaacaagattgaataaggaaatatgagatgcaaatattcatgtcaatctcctgaatagaattcttctatacaaaggaacttcaaattagagattag 35402389  T
Q  105 attgcatatcaaaagaacttcagaacgactaaatcaataagttggcaattggtgttcaacattgatt 171  Q
    ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  35402388 attgcatataaaaagaacttcagaacgactaaaccaataagttggcaattggtgttcaacattgatt 35402322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 19411984 - 19411924
Alignment:
Q  151 aattggtgttcaacattgattgtcatcttagaagtcaaaattaacctttttgtagaaagga 211  Q
    ||||||||||||||||||||| |||||| | ||||||| || || |||||||  |||||||    
T  19411984 aattggtgttcaacattgattctcatctcaaaagtcaagatcaagctttttgatgaaagga 19411924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University