View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14683_low_24 (Length: 203)

Name: NF14683_low_24
Description: NF14683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14683_low_24
NF14683_low_24
[»] chr6 (1 HSPs)
chr6 (20-136)||(33833806-33833922)
[»] chr8 (2 HSPs)
chr8 (54-131)||(43155717-43155794)
chr8 (54-125)||(43143611-43143682)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 33833922 - 33833806
Alignment:
Q  20 atttgttcatatctgatgatannnnnnnngttccacagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgat 119  Q
    |||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33833922 atttgttcatatctgatgatattttttttgttccacagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgat 33833823  T
Q  120 ggcaagtagcttctacc 136  Q
    |||||||||||||||||    
T  33833822 ggcaagtagcttctacc 33833806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 54 - 131
Target Start/End: Original strand, 43155717 - 43155794
Alignment:
Q  54 acagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgatggcaagtagctt 131  Q
    |||||| ||||| || || |||||||||||||||| ||| |||||| | |||||||| || |||||||||||||||||    
T  43155717 acagccctgttcgatgggctttgccactggtggaagaacattctttctttggggaggctgtatgatggcaagtagctt 43155794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 54 - 125
Target Start/End: Original strand, 43143611 - 43143682
Alignment:
Q  54 acagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgatggcaag 125  Q
    |||||||||||| || || |||| |||| |||||| ||| |||||| |||||||||| || |||||||||||    
T  43143611 acagccttgttcgatgggctttgacactagtggaagaacattctttctgtggggaggctgtatgatggcaag 43143682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University