View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14682_low_47 (Length: 205)

Name: NF14682_low_47
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14682_low_47
NF14682_low_47
[»] chr5 (2 HSPs)
chr5 (1-65)||(20746764-20746828)
chr5 (142-190)||(20746905-20746953)
[»] chr2 (2 HSPs)
chr2 (1-65)||(25815680-25815744)
chr2 (142-190)||(25815821-25815869)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 20746764 - 20746828
Alignment:
Q  1 tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20746764 tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag 20746828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 20746905 - 20746953
Alignment:
Q  142 attgtgttagttgttgctacataatttttagtagttactagtttttatt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  20746905 attgtgttagttgttgctacataatttttagtagttactagtttttatt 20746953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 25815680 - 25815744
Alignment:
Q  1 tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag 65  Q
    ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||    
T  25815680 tgtcaccattttttgttgctgtgttttcatcagtacgcaggggtgatctttttgggttgtaatag 25815744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 25815821 - 25815869
Alignment:
Q  142 attgtgttagttgttgctacataatttttagtagttactagtttttatt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  25815821 attgtgttagttgttgctacataatttttagtagttactagtttttatt 25815869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University