View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14682_low_19 (Length: 321)

Name: NF14682_low_19
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14682_low_19
NF14682_low_19
[»] chr7 (2 HSPs)
chr7 (24-129)||(33640797-33640902)
chr7 (170-302)||(33640601-33640741)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 24 - 129
Target Start/End: Complemental strand, 33640902 - 33640797
Alignment:
Q  24 aatgtaatcggtagaatatgtttgaaattgtgggtaggttcagaaataacaaggaggaatgaatgaaccctctttattgattgctgttgttatgaataag 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33640902 aatgtaatcggtagaatatgtttgaaattgtgggtaggttcagaaataacaaggaggaatgaatgaaccctctttattgattgctgttgttatgaataag 33640803  T
Q  124 gaaggt 129  Q
    ||||||    
T  33640802 gaaggt 33640797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 170 - 302
Target Start/End: Complemental strand, 33640741 - 33640601
Alignment:
Q  170 tgtccaattgtggttgtgaatttttgtttatttaatgatgagaaatgggaaatgattgggaacttattatgaagaaagag--------agagagggtgat 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||        ||||||||||||    
T  33640741 tgtccaattgtggttgtgaatttttgtttatttaatgatgagaaatgggaaatgattgggaacttattatgaagagagagagagagaaagagagggtgat 33640642  T
Q  262 gaattgattgatgacataacaaacaaaggaggagtaaacac 302  Q
    |||||||||||||||||||||||||||||||||| ||||||    
T  33640641 gaattgattgatgacataacaaacaaaggaggaggaaacac 33640601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University