View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14682_high_38 (Length: 206)

Name: NF14682_high_38
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14682_high_38
NF14682_high_38
[»] chr1 (1 HSPs)
chr1 (147-187)||(12450108-12450148)


Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 147 - 187
Target Start/End: Complemental strand, 12450148 - 12450108
Alignment:
Q  147 tctcaatccctatcaacaaaatcagtttcattcgaaatcca 187  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  12450148 tctcaatccctatcaacaaaatcagtttcattcgaaatcca 12450108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University