View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14678_low_20 (Length: 223)

Name: NF14678_low_20
Description: NF14678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14678_low_20
NF14678_low_20
[»] chr3 (1 HSPs)
chr3 (10-203)||(48990987-48991180)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 48991180 - 48990987
Alignment:
Q  10 cgagagagaagaaaccgagagccattatgaagagaaatgcgatgaaccagttacgttgccaaatcggaagctccgattcggaatggatcgtggattctct 109  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48991180 cgagagcgaagaaaccgagagccattatgaagagaaatgcgatgaaccagttacgttgccaaatcggaagctccgattcggaatggatcgtggattctct 48991081  T
Q  110 gtatataattcgggtcgacccggtttgtgattgttgcgaagatgaagaagagggttttcttcgtgataatcctccctgctgtgaacctgaggaa 203  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48991080 gtatatgattcgggtcgacccggtttgtgattgttgcgaagatgaagaagagggttttcttcgtgataatcctccctgctgtgaacctgaggaa 48990987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University