View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14677_low_11 (Length: 234)

Name: NF14677_low_11
Description: NF14677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14677_low_11
NF14677_low_11
[»] chr5 (2 HSPs)
chr5 (92-175)||(16508090-16508173)
chr5 (104-159)||(16508274-16508329)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 16508173 - 16508090
Alignment:
Q  92 ctaggtcatggttgtatccctcctagagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgctcgaggaagttaactc 175  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16508173 ctaggtcatggttgtatccctcctggagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgctcgaggaagttaactc 16508090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 16508329 - 16508274
Alignment:
Q  104 tgtatccctcctagagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgc 159  Q
    |||||| || |||||||| ||| ||||||| || ||||||||||||||||||||||    
T  16508329 tgtatctcttctagagtcatgaggtgcactgagaatgggtgtcgatgtgaaggtgc 16508274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University