View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14674_high_13 (Length: 316)

Name: NF14674_high_13
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14674_high_13
NF14674_high_13
[»] chr2 (2 HSPs)
chr2 (139-304)||(33619952-33620115)
chr2 (1-29)||(33620225-33620253)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 139 - 304
Target Start/End: Complemental strand, 33620115 - 33619952
Alignment:
Q  139 ttattgaagatttcatgaaaatcaatgtagctatactgccaaagtataattttgnnnnnnnnnnnactttctcaaaaacagttttgtgttaaacttgcaa 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||| |||||    
T  33620115 ttattgaagatttcatgaaaatcaatgtagctatactgccaaagtataatttttttttttcttt--ctttctcaaaaacagttttgtgttaaacatgcaa 33620018  T
Q  239 atggtcattgctaactcaaagaaaaaattgaaaagattggagctggctgaattacaaacctatgtc 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33620017 atggtcattgctaactcaaagaaaaaattgaaaagattggagctggctgaattacaaacctatgtc 33619952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33620253 - 33620225
Alignment:
Q  1 acatgattaacggtttcatatcagctggg 29  Q
    |||||||||||||||||||||||||||||    
T  33620253 acatgattaacggtttcatatcagctggg 33620225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University