View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14670_low_6 (Length: 233)

Name: NF14670_low_6
Description: NF14670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14670_low_6
NF14670_low_6
[»] chr7 (1 HSPs)
chr7 (91-215)||(1409603-1409727)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 91 - 215
Target Start/End: Complemental strand, 1409727 - 1409603
Alignment:
Q  91 agacccacgagaaattataccccaatgaagcttattaatcccagcagctaagaaatgagtttttaatgggtttttgattttgaattttctttaggtcaca 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  1409727 agacccacgagaaattataccccaatgaagcttattaatcccagcagctaagaaatgagtttttaatgggtttttgattttgaattttctttgggtcaca 1409628  T
Q  191 ggtttcgatttgcagaagaagagag 215  Q
    |||||||||||||||||||||||||    
T  1409627 ggtttcgatttgcagaagaagagag 1409603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University