View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14668_low_16 (Length: 237)

Name: NF14668_low_16
Description: NF14668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14668_low_16
NF14668_low_16
[»] chr4 (1 HSPs)
chr4 (17-220)||(33555178-33555381)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 33555381 - 33555178
Alignment:
Q  17 cataggttaattgtgttcacttcaaatgcaacaaaagaggcttctgaacgcattgcctatgaatggaactatgttgtggaaaataaatgtgagttcctct 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  33555381 cataggttaattgtgttcacttcaaatgcaacaaaagaggcttctgaacgcattgcctatgaatggaactatgttgtggaaaataaatgtgagtacctct 33555282  T
Q  117 tattttctgctaagatcagattatataccgtaaatgtaaatgacaatttcgatgactttgtgaaattgcagatggaaatgatggaatgggaagaggtcat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||    
T  33555281 tattttctgctaagatcagattatataccgtaaatgtaaatgacaatttcaatgactttgtgaaattgcagatggaaatgatggaatgggaagagatcat 33555182  T
Q  217 tgtt 220  Q
    ||||    
T  33555181 tgtt 33555178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University