View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14664_low_56 (Length: 238)

Name: NF14664_low_56
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14664_low_56
NF14664_low_56
[»] chr7 (1 HSPs)
chr7 (132-215)||(28265829-28265912)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 28265912 - 28265829
Alignment:
Q  132 ctgaaccgattattccatcaaatatctcaggaaatgacgagtaagctaagaacttcaaaatatctgttatcacttaattcaaca 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28265912 ctgaaccgattattccatcaaatatctcaggaaatgacgagtaagctaagaacttcaaaatatctgttatcacttaattcaaca 28265829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University