View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14664_high_31 (Length: 252)

Name: NF14664_high_31
Description: NF14664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14664_high_31
NF14664_high_31
[»] chr6 (1 HSPs)
chr6 (135-242)||(27792321-27792428)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 27792428 - 27792321
Alignment:
Q  135 ctattaatgaactgtgaccatgtcgaatcaaagtactaattagttccaactcataactactaacttagtatatatacctattttgtaatggtcattgata 234  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  27792428 ctattaatgaactgtgaccatttcgaatcaaaatactaattagttccaactcataactactaacttagtatatgtacctattttgtaatggtcattgata 27792329  T
Q  235 atgatatt 242  Q
     |||||||    
T  27792328 ctgatatt 27792321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University