View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14661_low_7 (Length: 229)

Name: NF14661_low_7
Description: NF14661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14661_low_7
NF14661_low_7
[»] chr8 (2 HSPs)
chr8 (126-209)||(43601446-43601529)
chr8 (12-89)||(43601369-43601446)


Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 126 - 209
Target Start/End: Original strand, 43601446 - 43601529
Alignment:
Q  126 taataaaatttgcggttacaaaaaacattttatcaagaatttgagttgttttagaaaataaattgtattatgagcttaactagt 209  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  43601446 taataaaatttgcggtttcaaaaaacattttatcaagaatttgagtttttttagaaaataaattgtattatgagcttaactagt 43601529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 43601369 - 43601446
Alignment:
Q  12 agaagcaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt 89  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43601369 agaaacaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt 43601446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University