View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14658_low_7 (Length: 278)

Name: NF14658_low_7
Description: NF14658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14658_low_7
NF14658_low_7
[»] chr2 (1 HSPs)
chr2 (20-189)||(41444269-41444439)
[»] chr5 (1 HSPs)
chr5 (193-262)||(2468109-2468178)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 41444439 - 41444269
Alignment:
Q  20 ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41444439 ggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctccccttattaattcttccatcttcagaactg 41444340  T
Q  120 tatagt-nnnnnnnnntattcctatctctcttttgcaaatctacataattctaccaaaacaaaggcagtga 189  Q
    ||||||          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  41444339 tatagtaaaaaaaaaatattcctatctctcttttgcaaatctacataattctaccaaaacaaaggaagtga 41444269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 193 - 262
Target Start/End: Complemental strand, 2468178 - 2468109
Alignment:
Q  193 agcagaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatca 262  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2468178 agcaaaacctgtgcttaagtcaccgacatctccaaatataggaattgaattcaaaccagtagcaaaatca 2468109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University