View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14654_high_14 (Length: 218)

Name: NF14654_high_14
Description: NF14654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14654_high_14
NF14654_high_14
[»] chr1 (1 HSPs)
chr1 (28-87)||(47776608-47776667)
[»] chr6 (1 HSPs)
chr6 (28-82)||(29220892-29220944)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 28 - 87
Target Start/End: Complemental strand, 47776667 - 47776608
Alignment:
Q  28 ttgagatcagaagtgaaagtgtgtgatttgggttggtttttaaggtgttttgattatgcg 87  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  47776667 ttgagatcagaagtgaaagtgtgtgatttgggttggtttttagggtgttttgattatgcg 47776608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 29220892 - 29220944
Alignment:
Q  28 ttgagatcagaagtgaaagtgtgtgatttgggttggtttttaaggtgttttgatt 82  Q
    ||||||||||||||||||||||  |||||||||| ||||||| ||||||||||||    
T  29220892 ttgagatcagaagtgaaagtgt--gatttgggtttgtttttagggtgttttgatt 29220944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University