View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14651_high_5 (Length: 257)

Name: NF14651_high_5
Description: NF14651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14651_high_5
NF14651_high_5
[»] chr3 (1 HSPs)
chr3 (139-250)||(32801876-32801987)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 139 - 250
Target Start/End: Complemental strand, 32801987 - 32801876
Alignment:
Q  139 attaaccacaaaaattaaaggagaataaaacttcgttttctattttggtaaagtatattataatgtaaaaaattgatgagataatgtaagagttgtttta 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||    
T  32801987 attaaccacaaaaattaaaggagaataaaacttcgttttctattttggtaaagtatattataatgtaaaaaattgatgagatgatgtaagagttgcttta 32801888  T
Q  239 ggtagctatttt 250  Q
    ||||||||||||    
T  32801887 ggtagctatttt 32801876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University