View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14650_low_3 (Length: 258)

Name: NF14650_low_3
Description: NF14650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14650_low_3
NF14650_low_3
[»] scaffold0155 (1 HSPs)
scaffold0155 (18-250)||(25787-26019)


Alignment Details
Target: scaffold0155 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 26019 - 25787
Alignment:
Q  18 caaagaaatgttacggtaagaaactattatactcattgtgcaatagatttcgatggcgatgatagcattcgcggtaggcttttgggtgcgaaaatagatt 117  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26019 caaagaaatgttacggtaagaaactattatactcgttgtgcaatagatttcgatggcgatgatagcattcgcggtaggcttttgggtgcgaaaatagatt 25920  T
Q  118 tggagctcaaaaattatccagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatatatgccc 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||    
T  25919 tggagctcaaaaattatccagacatggcttcacaaataggttttgttatgcaacacattgatgattgtattgatagtctgcataaaaatgatactagccc 25820  T
Q  218 aatactcgcaaaagatgttgatattcttcgaca 250  Q
    |||||| ||||| ||||||||||||||||||||    
T  25819 aatacttgcaaaggatgttgatattcttcgaca 25787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University