View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1464_high_7 (Length: 446)

Name: NF1464_high_7
Description: NF1464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1464_high_7
NF1464_high_7
[»] chr1 (1 HSPs)
chr1 (358-431)||(10612756-10612829)
[»] chr4 (1 HSPs)
chr4 (147-199)||(37972686-37972738)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 10612829 - 10612756
Alignment:
Q  358 aatactgaaaactcacttctcaatacctttctctctgtttcaaactctaagctatgataatatataaagaattt 431  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  10612829 aatactgaaaactcacttctcaatacctttctctctgcttcaaactctaagctatgataatatataaagaattt 10612756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 147 - 199
Target Start/End: Original strand, 37972686 - 37972738
Alignment:
Q  147 tgagttcatgagttgtgtgagcctattaacgaacaatataaagtgttgtcaca 199  Q
    ||||||||||||||| |||| || |||||| ||||||||| ||||| ||||||    
T  37972686 tgagttcatgagttgcgtgatcccattaacaaacaatatatagtgtagtcaca 37972738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University