View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14649_low_48 (Length: 253)

Name: NF14649_low_48
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14649_low_48
NF14649_low_48
[»] chr8 (1 HSPs)
chr8 (1-242)||(32146036-32146277)


Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 32146036 - 32146277
Alignment:
Q  1 ctgggtgcaaggatggattcaagtggtatgactcacctcaaccaaatcctaatgtggcatttggagctatagtgggtggccccttcttcaatgagacata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32146036 ctgggtgcaaggatggattcaagtggtatgactcacctcaaccaaatcctaatgtggcatttggagctatagtgggtggccccttcttcaatgagacata 32146135  T
Q  101 taatgattttaggaagaactcaatgcaggctgaacctaccacttacagtaatgcacttttagttgctctcctctctggcttggttgccagctcttcagta 200  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32146136 taatgattttaggaacaactcaatgcaggctgaacctaccacttacagtaatgcacttttagttgctctcctctctggcttggttgccagctcttcagta 32146235  T
Q  201 gtttcgtctttctagaatccatatatatgtatatgatccaat 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  32146236 gtttcgtctttctagaatccatatatatgtatatgatccaat 32146277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University