View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14649_high_24 (Length: 366)

Name: NF14649_high_24
Description: NF14649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14649_high_24
NF14649_high_24
[»] chr2 (2 HSPs)
chr2 (148-350)||(31658583-31658785)
chr2 (9-46)||(31658521-31658558)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 148 - 350
Target Start/End: Original strand, 31658583 - 31658785
Alignment:
Q  148 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31658583 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt 31658682  T
Q  248 caatcgatgatagcatagtggcatgtctcaaataatcaaaacaaaattcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga 347  Q
    ||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31658683 caatcgatgatagcatagtggcacgtctcaaataatcaaaataaacttcaaagttacatgatatgaggttatctgatgagaacaattgattttgagaaga 31658782  T
Q  348 ata 350  Q
    |||    
T  31658783 ata 31658785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 9 - 46
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
Q  9 gacatcatcagttaaacgatcaaataaatctcccatta 46  Q
    |||||||| |||||||||||||||||||||||||||||    
T  31658521 gacatcataagttaaacgatcaaataaatctcccatta 31658558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University