View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14645_low_3 (Length: 289)

Name: NF14645_low_3
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14645_low_3
NF14645_low_3
[»] chr1 (2 HSPs)
chr1 (229-274)||(22792646-22792691)
chr1 (239-274)||(48171805-48171840)
[»] chr2 (1 HSPs)
chr2 (239-274)||(43971882-43971917)
[»] chr8 (2 HSPs)
chr8 (229-274)||(3016050-3016095)
chr8 (239-271)||(18935420-18935452)


Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 22792691 - 22792646
Alignment:
Q  229 gtttaatggaatgtttggtcccatatgtttattttaggtttcaagt 274  Q
    ||||||| | ||||||||||||||||||||||||||||||| ||||    
T  22792691 gtttaattgtatgtttggtcccatatgtttattttaggttttaagt 22792646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Complemental strand, 48171840 - 48171805
Alignment:
Q  239 atgtttggtcccatatgtttattttaggtttcaagt 274  Q
    |||||||||||| |||||||||||||||||||||||    
T  48171840 atgtttggtcccttatgtttattttaggtttcaagt 48171805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 239 - 274
Target Start/End: Complemental strand, 43971917 - 43971882
Alignment:
Q  239 atgtttggtcccatatgtttattttaggtttcaagt 274  Q
    |||||||||||| |||||||||||||||||||||||    
T  43971917 atgtttggtcccttatgtttattttaggtttcaagt 43971882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 3016095 - 3016050
Alignment:
Q  229 gtttaatggaatgtttggtcccatatgtttattttaggtttcaagt 274  Q
    ||||||| | |||||||||||| || ||||||||||||||||||||    
T  3016095 gtttaattgcatgtttggtcccttaagtttattttaggtttcaagt 3016050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 271
Target Start/End: Complemental strand, 18935452 - 18935420
Alignment:
Q  239 atgtttggtcccatatgtttattttaggtttca 271  Q
    |||||||||||| ||||||||||||||||||||    
T  18935452 atgtttggtcccttatgtttattttaggtttca 18935420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University