View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14645_high_3 (Length: 236)

Name: NF14645_high_3
Description: NF14645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14645_high_3
NF14645_high_3
[»] chr8 (2 HSPs)
chr8 (107-218)||(28484777-28484888)
chr8 (1-39)||(28484671-28484709)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 28484777 - 28484888
Alignment:
Q  107 tcaggaacaccaggggaaaaagaagagaaagtttctttggatctcagtgaagaaattcttctcagtatggaagttggaatgtccttcaaagattacgtaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28484777 tcaggaacaccaggggaaaaagaagagaaagtttctttggatctcagtgaagaaattcttctcagtatggaagttggaatgtccttcaaagattacgtaa 28484876  T
Q  207 ccaatttctact 218  Q
    ||||||||||||    
T  28484877 ccaatttctact 28484888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 28484671 - 28484709
Alignment:
Q  1 catcttcaacaatgggtggtacaccaaaattatcactac 39  Q
    ||||||||||||||||||||||||| |||||||||||||    
T  28484671 catcttcaacaatgggtggtacacctaaattatcactac 28484709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University