View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14642_low_69 (Length: 218)

Name: NF14642_low_69
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14642_low_69
NF14642_low_69
[»] chr3 (2 HSPs)
chr3 (24-153)||(32375976-32376105)
chr3 (89-146)||(32364244-32364303)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 153
Target Start/End: Complemental strand, 32376105 - 32375976
Alignment:
Q  24 acttgctgctcccatcacgcttggcagaggaggcctcaagtaaatgatttaacctaataataaatggattaagtatgaaactacttaaagaaccatacaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
T  32376105 acttgctgctcccatcacgcttggcagaggaggcctcaagtaaatgatttaaccttataataaatggattaagtatgaaactacttaaggaaccatacaa 32376006  T
Q  124 ttacagtagatttttaccagaactgatgat 153  Q
    |||||||||||||||||||||||| |||||    
T  32376005 ttacagtagatttttaccagaactaatgat 32375976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 146
Target Start/End: Complemental strand, 32364303 - 32364244
Alignment:
Q  89 ggattaagtatgaaactacttaaagaacc--atacaattacagtagatttttaccagaac 146  Q
    ||||||||||||||||||||||  |||||  |||||||||| |||||| |||||||||||    
T  32364303 ggattaagtatgaaactacttatggaaccatatacaattacggtagatatttaccagaac 32364244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University