View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14642_low_63 (Length: 228)

Name: NF14642_low_63
Description: NF14642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14642_low_63
NF14642_low_63
[»] chr2 (1 HSPs)
chr2 (23-211)||(32971423-32971609)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 32971423 - 32971609
Alignment:
Q  23 cccgattctatgcaatctcatgtgattgatgatcatgtatttagtgcaaacatgct-aaaaaagagattggagggatcaatattgtaggttgtaatgaca 121  Q
    |||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||    
T  32971423 cccgattccatgcaatctcatgtgattgaagatcatgtatttagtgcaaacatgctaaaaaaagagattggagggatcaatattgtaggtggtaatgaca 32971522  T
Q  122 aaattaaccccnnnnnnnttaaatgtggagaatcctattcccatgtctgcatatttgtaaaagaagtaatgcaatttattatggtcatag 211  Q
    |||||||||||       |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  32971523 aaattaacccc---aaaattaaatatggagaatcctattcccatgtctacatatttgtaaaagaagtaatgcaatttattatggtcatag 32971609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University