View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14640_low_7 (Length: 392)

Name: NF14640_low_7
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14640_low_7
NF14640_low_7
[»] chr1 (1 HSPs)
chr1 (1-83)||(9883938-9884021)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 9883938 - 9884021
Alignment:
Q  1 aataaaattagatgaataaatctatatcttctata-taatataggaaagaaagatgttgcggaaaatacaacactacccttatt 83  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||    
T  9883938 aataaaattagatgaataaatctatatcttctatagtaatataggaaagaaagatgttgtggaaaatacaacactacccttatt 9884021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University