View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14640_low_17 (Length: 297)

Name: NF14640_low_17
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14640_low_17
NF14640_low_17
[»] chr4 (1 HSPs)
chr4 (1-284)||(24345278-24345560)


Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 24345560 - 24345278
Alignment:
Q  1 ctcaccaaaacccttccctttgttgcagcattttccggttttggtgatccaattccatggttgatttgtctagcttttttctttgctaaaggttttatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24345560 ctcaccaaaacccttccctttgttgcagcattttccggttttggtgatccaattccatggttgatttgtctagcttttttctttgctaaaggttttatca 24345461  T
Q  101 aaactggattaggtaaccgtgttgcgtatcaatttgtgaagctttttggtagttcttcattaagggttaggttatagtttggtttttagtgaagcattgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  24345460 aaactggattaggtaaccgtgttgcgtatcaatttgtgaagctttttggtagttcttcatt-agggttaggttatagtttggtttttagtgaagcattgt 24345362  T
Q  201 tagctccggcgattccttcggtttcggcaagggctggtgagannnnnnnactgttggttaagtctctttgtgttgcttgtggaa 284  Q
    ||||||||||||||||||||||||||||||||||||||| ||       || ||||||||||||||||||||||||||||||||    
T  24345361 tagctccggcgattccttcggtttcggcaagggctggtgggatatttttaccgttggttaagtctctttgtgttgcttgtggaa 24345278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University