View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14640_high_24 (Length: 254)

Name: NF14640_high_24
Description: NF14640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14640_high_24
NF14640_high_24
[»] chr2 (1 HSPs)
chr2 (16-187)||(37916323-37916494)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 37916323 - 37916494
Alignment:
Q  16 ataatactataaataatggcttcataattattcagtcaaatttgattgagtgcctattgggaaatcttcatggaatctttttctttcttagtaggtggct 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  37916323 ataatactataaataatggcttcataattattcagtcaaatttgattgagtggctattgggaaatcttcatggaatctttttctttcttagtaggtggct 37916422  T
Q  116 tgtgatgtttgtagtggtgttgggcggaggtagtgatcggggctggcccatatacccataatatgtggaatc 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37916423 tgtgatgtttgtagtggtgttgggcggaggtagtgatcggggctggcccatatacccataatatgtggaatc 37916494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University