View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1463_low_10 (Length: 218)

Name: NF1463_low_10
Description: NF1463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1463_low_10
NF1463_low_10
[»] chr2 (1 HSPs)
chr2 (16-124)||(16381091-16381199)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 16381199 - 16381091
Alignment:
Q  16 gattataactatgaaaacaaagggtgggtagaaaacatttgaaccatgaaatgcaaaggaatatgtgatagtgctttgactttgtatcttgtaattttgt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||    
T  16381199 gattataactatgaaaacaaagggtgggtagaaaacatttgaaccatgaaatgtagaggaatatgtgatagtgctttgactttgtatcttgtaattttgt 16381100  T
Q  116 aatcttaag 124  Q
    |||||||||    
T  16381099 aatcttaag 16381091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University