View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14638_low_33 (Length: 227)

Name: NF14638_low_33
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14638_low_33
NF14638_low_33
[»] chr3 (1 HSPs)
chr3 (7-227)||(38090652-38090872)
[»] chr4 (1 HSPs)
chr4 (57-147)||(32730830-32730920)


Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 38090652 - 38090872
Alignment:
Q  7 taattataaattatattgctcttttgttgttgcttgaattaggctggaattgggtatgcgaggaagataacttatgaagatattacacttattaaagtaa 106  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  38090652 taattataaattatattgctcttttgttgttgattgaattaggctggaactgggtatgcgaggaagataacatatgaagatattacacttattaaagtaa 38090751  T
Q  107 ataaccctataattattgatcaacactacgacgctttagaaagtgtaagcgatagtgtccgtaaaggagtgaaagtgagtgatgttacttttcgtggctt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38090752 ataaccctataattattgatcaacactacgacgctttagaaagtgtaagcgatagtgtccgtaaaggagtgaaagtgagtgatgttacttttcgtggctt 38090851  T
Q  207 tcggggaaccgcaaatgagaa 227  Q
    ||||||||| |||||||||||    
T  38090852 tcggggaactgcaaatgagaa 38090872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 147
Target Start/End: Original strand, 32730830 - 32730920
Alignment:
Q  57 tgggtatgcgaggaagataacttatgaagatattacacttattaaagtaaataaccctataattattgatcaacactacgacgctttagaa 147  Q
    ||||||||| || |||||||| |||||||||||||   || |||||||  | || ||| | |||||||||||||| |||||||||||||||    
T  32730830 tgggtatgctagaaagataacatatgaagatattattgtttttaaagtggagaatcctgtgattattgatcaacagtacgacgctttagaa 32730920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University