View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14638_high_23 (Length: 249)

Name: NF14638_high_23
Description: NF14638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14638_high_23
NF14638_high_23
[»] chr4 (1 HSPs)
chr4 (18-239)||(22421733-22421954)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 22421954 - 22421733
Alignment:
Q  18 agaaaatggcgtcggagattttcaacatgccggtggaggattgggataaatggggggataattttgagaaaccgtttggtgaagggagtttgtcgggttc 117  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||| |||||||||||||||||||||||||  ||||||||    
T  22421954 agaaaatggcgtcggagattttcaacatgccggtgaaggattgggatgaatggggagataatttcgagaaaccgtttggtgaagggagttcttcgggttc 22421855  T
Q  118 gacgagtcggaacgatgatagtccggttgttagggtttattttaagggtttagtgagtgaggaggttgtgagaggtgagaatgtttctttggctgggatt 217  Q
    |||||  |||||| ||||  ||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| |||||||||||||||||||    
T  22421854 gacgatgcggaacaatgaaggtccggttgttagggtttattttaagggtttagtgagtgaggagagtgtgagaggtgagagtgtttctttggctgggatt 22421755  T
Q  218 ggtgttgctgtttgtgatgatg 239  Q
    ||||||||||||||||||||||    
T  22421754 ggtgttgctgtttgtgatgatg 22421733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University