View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14637_low_7 (Length: 225)

Name: NF14637_low_7
Description: NF14637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14637_low_7
NF14637_low_7
[»] chr8 (2 HSPs)
chr8 (16-126)||(7253262-7253378)
chr8 (165-212)||(7253210-7253256)


Alignment Details
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 7253378 - 7253262
Alignment:
Q  16 aatctcacatggaatatataactataatattgggcgatatgttattctaagtgttagt-------aatctaaagaagataagttttaaaacttttgaaag 108  Q
    ||||||||||||||||||||| |||||||||||||||  ||||||||| |||||||||       |||||||||||||||||||||||||||||||||||    
T  7253378 aatctcacatggaatatataattataatattgggcgac-tgttattctcagtgttagttagtagtaatctaaagaagataagttttaaaacttttgaaag 7253280  T
Q  109 agtcttaataacacattc 126  Q
    ||| ||| ||||| ||||    
T  7253279 agtgttagtaacatattc 7253262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 7253256 - 7253210
Alignment:
Q  165 acataatcacgtatgtcctttataacatacattttatactcgactgaa 212  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||    
T  7253256 acataatcacgtatgtcctttataacataca-tttatattcgactgaa 7253210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University