View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14630_low_17 (Length: 226)

Name: NF14630_low_17
Description: NF14630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14630_low_17
NF14630_low_17
[»] chr2 (1 HSPs)
chr2 (15-211)||(41094625-41094821)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 41094625 - 41094821
Alignment:
Q  15 atagggtgaatattgaggaatctaggagaatggaggggaaggccgtatgtgctctttttagggtagagtggctttgggattttatttgagagttatcgtc 114  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41094625 atagggtgagtattgaggaatctaggagaatggaggggaaggccgtatgtgctctttttagggtagagtggctttgggattttatttgagagttatcgtc 41094724  T
Q  115 atgattagctgtttgacttctctactagggcatacatgctccaccgtgtaccattttggtagacaagatccacaaatcttccatatgccaaatatct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41094725 atgattagctgtttgacttctctactagggcatacatgctccaccgtgtaccattttggtagacaagatccacaaatcttccatatgccaaatatct 41094821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University