View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14630_high_7 (Length: 328)

Name: NF14630_high_7
Description: NF14630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14630_high_7
NF14630_high_7
[»] chr1 (1 HSPs)
chr1 (179-312)||(52518819-52518952)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 179 - 312
Target Start/End: Complemental strand, 52518952 - 52518819
Alignment:
Q  179 ctaagggctgaatatattaagttttgaatggcatcaatatcttgttttagtaagagtccattgcccatgaaagagacagctttgagccatggtgaatatc 278  Q
    ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  52518952 ctaagggctgaatatattaagttgtgaatggcatcaacatcttgttttagtaagagtccattacccatgaaagagacagctttgagccatggtgaatatc 52518853  T
Q  279 ctccacctatggcaacttatgaggaggttgtaga 312  Q
    ||||||||||||||||||||||||||||||||||    
T  52518852 ctccacctatggcaacttatgaggaggttgtaga 52518819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University