View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14629_low_43 (Length: 227)

Name: NF14629_low_43
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14629_low_43
NF14629_low_43
[»] chr2 (1 HSPs)
chr2 (7-227)||(13139978-13140198)
[»] chr8 (1 HSPs)
chr8 (50-78)||(5521726-5521754)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 13139978 - 13140198
Alignment:
Q  7 tacacggctaaatttcaatgaatattttgatttatgtaatctttttaatttaaaatatcaaacttgaaatttaaattgtcttgatctcgatcaaacgacc 106  Q
    |||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  13139978 tacacggctaaatttcaatgaagattttgatttatataatctttttaatttaaaatatcaaacttaaaatttaaattgtcttgatctcgatcaaacgacc 13140077  T
Q  107 taaatatggttgactacttgaagtcgctgggttgtgaccgcatacaacccatattgccacatgatgttacaagaggttacattacatgatctatatactc 206  Q
    |||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||    
T  13140078 taaatatggttgactatttgaagtcgctggattgtgaccgcatacaacccatattaccaccttatgttacaagaggttacattacatgatctatatactc 13140177  T
Q  207 ttagagagtaagttagtagca 227  Q
    |||||||||||||||||||||    
T  13140178 ttagagagtaagttagtagca 13140198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 78
Target Start/End: Complemental strand, 5521754 - 5521726
Alignment:
Q  50 tttaatttaaaatatcaaacttgaaattt 78  Q
    |||||||||||||||||||||||||||||    
T  5521754 tttaatttaaaatatcaaacttgaaattt 5521726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University