View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14628_low_12 (Length: 201)

Name: NF14628_low_12
Description: NF14628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14628_low_12
NF14628_low_12
[»] chr1 (1 HSPs)
chr1 (35-172)||(43664706-43664843)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 35 - 172
Target Start/End: Complemental strand, 43664843 - 43664706
Alignment:
Q  35 gagagagaggaaaagataaaagataaaatactttaccaactttgatatatttgttattgtataattttagaaggaattgatgttgccatgcatgaaagag 134  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||    
T  43664843 gagagagaggaaaagataaacgataaaatactttaccaactttgatatatttgttattgtataattttagaagaaattgatgttgccatgcatgaaatag 43664744  T
Q  135 gacatgtgaattttacgatctccaaagatttctattag 172  Q
    ||||||||||||||||||||||||||||||||||||||    
T  43664743 gacatgtgaattttacgatctccaaagatttctattag 43664706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University