View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14623_low_42 (Length: 210)

Name: NF14623_low_42
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14623_low_42
NF14623_low_42
[»] chr7 (2 HSPs)
chr7 (124-192)||(39416487-39416555)
chr7 (16-60)||(39416619-39416663)


Alignment Details
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 192
Target Start/End: Complemental strand, 39416555 - 39416487
Alignment:
Q  124 gttacccagaaagtgaagtgtttcttcacacgatgcagctcctaannnnnnngcttcgattttgatttt 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
T  39416555 gttacccagaaagtgaagtgtttcttcacacgatgcagctcctaatttttttgcttcgattttgatttt 39416487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 39416663 - 39416619
Alignment:
Q  16 gaactaagacgaaattgcgatgttctgttctgttcatatatgaat 60  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  39416663 gaactaagacgaaattgcgatgttctgttctgttcatatatgaat 39416619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University