View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1461_low_31 (Length: 222)

Name: NF1461_low_31
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1461_low_31
NF1461_low_31
[»] chr2 (2 HSPs)
chr2 (11-165)||(36525666-36525822)
chr2 (174-211)||(36525226-36525263)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 36525822 - 36525666
Alignment:
Q  11 aactttaggtaaattttgagaatatgtttgtcaaaactttgtgctgaatataaactctccatgaatttgtc--nnnnnnnnctctccatgaaaaataaat 108  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||    
T  36525822 aactttaggtaaattttgagaatatgtttgtctaaactttgtgctgaatataaactctccatgaatttgtcaaaaaataaactctccatgaaaaataaat 36525723  T
Q  109 agtaacataagaacagaaattgaataagctttcaatatgatactaacattagcctat 165  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||  ||||||||    
T  36525722 agtaacataagaacagaaattgaataacctttcaatatgatactaacgctagcctat 36525666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 36525263 - 36525226
Alignment:
Q  174 ttatcctttcattttcttcgtgcacaatctttcttcat 211  Q
    |||||||||||||||||||||||| |||||||||||||    
T  36525263 ttatcctttcattttcttcgtgcataatctttcttcat 36525226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University