View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1461_low_30 (Length: 223)

Name: NF1461_low_30
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1461_low_30
NF1461_low_30
[»] chr4 (1 HSPs)
chr4 (1-203)||(30107640-30107843)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 30107843 - 30107640
Alignment:
Q  1 aaaatcctgccataccgttcactttgtggtgct--catatcggattatggcggaaaatccccaatnnnnnnnttgtttgtaatttaacctgtggggcaac 98  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
T  30107843 aaaatcctgccataccgttcactttgtggtgctgtcatatcggattatggcggaaaatccccaataaaaaa-ttgtttgtaatttaacctgtggggcaac 30107745  T
Q  99 ttttgacccccagtatcacttcggatgcacacatgcaggaaaacgtgaattttgtgccgtttggaagtacacttccagaaacaccagtggtgttttaaga 198  Q
    ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  30107744 ttttgacccccagtatcacttcggacgcacacatccaggaaaacgtgaattttgtgccgtttggaagtacacttccagaaacaccagtagtgttttaaga 30107645  T
Q  199 aatgt 203  Q
    |||||    
T  30107644 aatgt 30107640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University