View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14616_high_30 (Length: 242)

Name: NF14616_high_30
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14616_high_30
NF14616_high_30
[»] chr4 (1 HSPs)
chr4 (1-223)||(52380582-52380810)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 52380582 - 52380810
Alignment:
Q  1 cctttgaacacgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctctattcgccgctcaggtacactttcgtc 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||    
T  52380582 cctttgaacccgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctctattcgccgctcaggtacgctttcttc 52380681  T
Q  101 ccctactgattttgttt------ttgcacagtgatcacgatcatactaatttatttttctgtgtgtgcagggtattaaactaggactatcttccacttct 194  Q
    |||||||||||||||||      ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||    
T  52380682 ccctactgattttgtttttgcagttgcacagtgatcacgatcatactaatttatctttctgtgtgtgcagggtgttaaactaggactatcttccacttct 52380781  T
Q  195 aagattttgcacttttcatccaaaggttc 223  Q
     ||||||||||||||||||||||||||||    
T  52380782 cagattttgcacttttcatccaaaggttc 52380810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University