View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14616_high_23 (Length: 282)

Name: NF14616_high_23
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14616_high_23
NF14616_high_23
[»] chr4 (1 HSPs)
chr4 (19-267)||(32582305-32582553)


Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 32582553 - 32582305
Alignment:
Q  19 gttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaacgatgaagatgcagcgtcgagttgtggaagtaaccaccatgtcaaggag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  32582553 gttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaacgatgacgatgcagcgtcgagttgtggaagtaaccaccatgtcaaggag 32582454  T
Q  119 gaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggagaaagggagtcagtagtgctgttactgccatgtaggcatt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  32582453 gaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggggaaagggagtcagtagtgctgttactgccatgtaggcatt 32582354  T
Q  219 tgtgtttgtgtacaatgtgtgggacccacattcgtaattgccccctttg 267  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||    
T  32582353 tgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctctttg 32582305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University