View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14614_low_58 (Length: 261)

Name: NF14614_low_58
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14614_low_58
NF14614_low_58
[»] chr6 (2 HSPs)
chr6 (136-230)||(31093208-31093302)
chr6 (139-231)||(31033934-31034026)
[»] scaffold0202 (1 HSPs)
scaffold0202 (47-231)||(1856-2020)
[»] scaffold0016 (2 HSPs)
scaffold0016 (142-231)||(30980-31069)
scaffold0016 (25-82)||(30870-30927)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 136 - 230
Target Start/End: Original strand, 31093208 - 31093302
Alignment:
Q  136 ttaaaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttagga 230  Q
    ||||||||||||||||||||||||||||||||||||||| ||| |  ||||||||||||||||||||||||||||||||||||||||||||||||    
T  31093208 ttaaaatgctttcccggaactggatgagatcaaaatcattgggatatggatatgcaatatcacattagtggactaaccctctagcttgtttagga 31093302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 231
Target Start/End: Complemental strand, 31034026 - 31033934
Alignment:
Q  139 aaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 231  Q
    ||||||||||| | |||||||| || ||| ||||||| ||||  |||||| |||||||  | | ||||||||||||| || ||| ||||||||    
T  31034026 aaatgctttcctgaaactggataaggtcataatcatcagggtttggatattcaatatcgaagtcgtggactaaccctttaccttttttaggag 31033934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0202
Description:

Target: scaffold0202; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 47 - 231
Target Start/End: Original strand, 1856 - 2020
Alignment:
Q  47 cttgtctatggtgtatttggaaggctaggaatgcgagnnnnnnnntcacgatataagtgtttcgactgatactattttagaactgcattttaaaatgctt 146  Q
    ||||||||| ||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||| ||||| |    |||||||||||    
T  1856 cttgtctatagtgtatttggaaggctaggaatgcga--aaaaaattcacgatataagtgtttcgactgatactatttcagaacagg---ttaaaatgctt 1950  T
Q  147 tcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 231  Q
    ||| ||||| ||||||||||                |||||||||||||||||||||||||||||||||||||||||||||||||    
T  1951 tcctggaaccggatgagatct---------------ggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 2020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 142 - 231
Target Start/End: Original strand, 30980 - 31069
Alignment:
Q  142 tgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 231  Q
    |||||||| | |||||||| || |||||||||||| |||  ||||||||||||||| | | |||||||||||||||| ||| ||||||||    
T  30980 tgctttcctgaaactggataaggtcaaaatcatcgaggtttggatatgcaatatcaaagttgtggactaaccctctaccttttttaggag 31069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 30870 - 30927
Alignment:
Q  25 ggtataagaatgatttgaattgcttgtctatggtgtatttggaaggctaggaatgcga 82  Q
    ||||||||||  |||||| ||||||||||||||  |||| ||||||||| ||||||||    
T  30870 ggtataagaacaatttgacttgcttgtctatggattattgggaaggctaagaatgcga 30927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University