View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1460_low_42 (Length: 316)

Name: NF1460_low_42
Description: NF1460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1460_low_42
NF1460_low_42
[»] chr4 (1 HSPs)
chr4 (10-300)||(50393616-50393906)


Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 10 - 300
Target Start/End: Complemental strand, 50393906 - 50393616
Alignment:
Q  10 aagaaaatcattttcgttaaaagtgataaatatttgctgtacttgccattgattttggtcttgtctatgtgccatttgtattataattatctccggtgaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50393906 aagaaaatcattttcgttaaaagtgataaatatttgctgtacttgccattgattttggtcttgtctatgtgccatttgtattataattatctccggtgaa 50393807  T
Q  110 tgattccatgcatgataactgtacggcttgatacagggtgtagaaggccactagcagcagcaaacatcatcccataacatatttaaactaaatatagaaa 209  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50393806 tgattccatgcatgataactgtacggcttgatacggggtgtagcaggccactagcagcagcaaacatcatcccataacatatttaaactaaatatagaaa 50393707  T
Q  210 tgatatcagttaactagctagtaaagagaaatcaaaatacgatgagttgaaactgatacttatatgttctaaacaaactaaccgaaccaac 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50393706 tgatatcagttaactagctagtaaagagaaatcaaaatacgatgagttgaaactgatacttatatgttctaaacaaactaaccgaaccaac 50393616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University